fkityoloo
fkityoloo fkityoloo
  • 02-05-2016
  • Chemistry
contestada

Fusion is a type of

Respuesta :

Samberkebile Samberkebile
  • 02-05-2016
A type of a Nuclear Reaction
Answer Link
jennicacashjenna
jennicacashjenna jennicacashjenna
  • 02-05-2016
i think it is type of 
nuclear reaction
Answer Link

Otras preguntas

the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim
The most famous trade route, the silk road, connected _____________ with _________ and ___________.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
20% of what number is equal to 2/3 of 90?
Mark bought a set of 6 flower pots of different sizes at a total cost of $8.25. each pot cost $0.25 more than the next one below it in size. what was the cost,
Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1
What did Theodore Roosevelt do before he was elected president at the age of 42?
why does the troposphere experience the greatest amount of atmospheric pressure compared to the other atmospheric layers?
a trip to the ocean can be a relaxing escape from the everyday pressures of life. A Sailboat glistening on the horizon provides a mental escape to faraway place
You are on standby at a sporting event when an infant nearby suddenly begins to cough