marrerotytianna
marrerotytianna marrerotytianna
  • 01-11-2020
  • Mathematics
contestada

What is the rate in cups of vinegar per teaspoon of lemon oil?

Respuesta :

kristeneady1234 kristeneady1234
  • 01-11-2020
The rate of the cups of vinegar per tablespoon of lemon oil is two per tablespoon rates in cups
Answer Link
halsigar000 halsigar000
  • 10-11-2020

Answer:

1/4c of vinegar for 2 tsp of lemon oil

Step-by-step explanation:

Answer Link

Otras preguntas

What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
why is the square root of a perfect square always rational
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
Where did middle names come from