bran5dyr7ock bran5dyr7ock

01-10-2016
Mathematics

contestada

estimate square root 15 to nearest tenth!!

Respuesta :

Аноним Аноним

01-10-2016

The square root of 15 is 3.87,
If we are to round the the tenth I'd be 4.

Answer Link

Otras preguntas

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Which of the following is a tip for making sure you are messaging safely? A.Always use your full name. B.Be careful who you allow on your buddy list. C.Fill in

Recommend TWO ways in which a person should approach conflict resolution in order to sustain health relationships.

Add and Subtract Linear Expressions 1. Subtract m + 8 from 5m + 11. Enter your answer in the box. 2. Add the two expressions. −4.2x+3 and 2.5x−6 Enter your a

20 POINTS PLEASE HELPIm not good at theseWhich sentence correctly uses commas to enclose nonessential elements?A. Ned is studying wildlife, on the Galápagos Isl

Find the value of 35° 9

Please help I need to get this done and I have no idea what I'm doing!

please help asap!! :0

Between the left atrium and left ventricle, blood flows through the bicuspid valve. True False

Help me please please help me