koko7817
koko7817 koko7817
  • 03-06-2021
  • Mathematics
contestada

The value of the 1 in 1,255 is
times the value of the 1 in 82,175.

Respuesta :

ayomidemathins72
ayomidemathins72 ayomidemathins72
  • 03-06-2021

Step-by-step explanation:

[tex]1 = 1000[/tex]

[tex]1 = 100[/tex]

[tex]1000 \times \frac{1}{10} = 100[/tex]

Answer Link

Otras preguntas

In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
in what area of Europe were the majority of warsaw pact countries
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before