duolingocom4
duolingocom4 duolingocom4
  • 04-02-2017
  • Mathematics
contestada

Which measure is equivalent to 3 mi?

1 ft = 12 in.

1 mi = 5280 ft



440 in.

15,840 in.

63,360 in.

190,080 in.

Respuesta :

Jieep
Jieep Jieep
  • 04-02-2017
190,080 is the correct answer because 63,360 inches are in a mile. Multiply that by three, and you get 190,080.
Answer Link
JackelineCasarez JackelineCasarez
  • 09-02-2019

Answer:

The 3 mi is equivalent to 190080 in.

Step-by-step explanation:

As given

1 mi = 5280 ft

1 ft = 12 in

Now first convert 3mi into ft .

3mi = 3 × 5280

      = 15840 ft

Now convert 15840 ft into in .

15840 ft = 12 × 15840 in

              = 190080 in

Therefore  the 3 mi is equivalent to 190080 in.

Answer Link

Otras preguntas

The triangle has side lengths 7,10,and 12 is it a right triangle
Help please? I'm not really sure what to do here.
"Solve using mental math. Draw a strip diagram and fill the blanks to show your thinking."someone help me ​ASP I GOTTA GO TO SCHOOL SOON
what do you mean by seasonal market/
Order the items from most general to most specific.snakereptile python animal​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
What did white Southerners do in response to the new freedoms of African Americans?
math problem help to do this step by step ​
Which of the following best describes the ego? A. The ego tries to meet the needs of the id while taking into account the reality of the situation. B. The ego i
"Freee" pointssss just say you're opinion on this :)“You can tell the story of white leadership in America and never mention the FBI one time, but you can’t tel