dentonclone189509 dentonclone189509

02-11-2022
Mathematics

contestada

Select the ordered pairs below that are solutions to this linear equation: y = 5x - 2

Respuesta :

sadiemoe06 sadiemoe06

02-11-2022

y=(2,5) Sorry if I was wrong

Answer Link

Otras preguntas

How might the history of korea have been different if united nations forces had not stepped into oppose the north korean invasion in 1950?

What are some examples of dramatic irony in The Hobbit?

The basis of freedom of religion is found in which two principles in the bill of rights

There are only three types of polygons that can be the faces of a Platonic solid. They are _____, _____, and _____. Check all that apply. A. rectangles B. squar

Collusive strategies are the third type of cooperative strategies. In many economies, explicit collusive strategies are legal unless otherwise sanctioned by gov

In judith ortiz cofer's "gravity," what is elenita's main internal conflict? a.she wants an independent identity, and yet still feels a connection to others. b.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new

PLEASE HELP ME ASAPPP Identify the base of a triangle in which h = 5 ft and A = (5x + 20) ft2 .

If an employee gets potentially infectious material splashed in his eye, what should he do?