gamergirl1977ge
gamergirl1977ge gamergirl1977ge
  • 04-03-2017
  • Arts
contestada

The most preferred surface in lithography is        A. limestone.   B. marble.   C. granite.   D. lead.

Respuesta :

Masamunesenpai Masamunesenpai
  • 04-03-2017
A. Limestone. Limestone is the smooth surface like a metal plate. I thought u were suppose to use limestone in lithography :|
Answer Link

Otras preguntas

accurate estimation 719-348
The section of the small intestine between the duodenum and ilium?
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
What were the driving forces behind the industrial revolution
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
What property is shown by the equation? 1. 0 ÷ (–6) = 0