DayDreamer999 DayDreamer999
  • 02-04-2015
  • World Languages
contestada

What is the best way to memorize arabic vocabulary?

Respuesta :

secret13 secret13
  • 02-04-2015
Write the pronunciation in your own language.. Like "Hi" in Arabic is هناك and the English way to write in Arabic is "Honaqa" 
Answer Link
aubreydoskyVT aubreydoskyVT
  • 09-04-2015
I like using songs, so use flashcards but sing it as a song. I will also say try downloading kid arabic songs it's how I learned the alphabet in Arabic because it's so catchy. Good Luck!!
Answer Link

Otras preguntas

what is 15/24 in simplest form
p(x) x^3+x^2-x-1 Find all zeros of p (x)
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
A light bulb converts electrical energy into electromagnetic energy is true or false?
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
Why was wilson not able to finish his speaking tour